Containment Class:
euclid
A section of SCP-CN-1123-███
Special Containment Procedures: Due to the special properties of SCP-CN-1123, it is currently impossible to fully contain the anomaly. All ███ decoded SCP-CN-1123 specimens are to be stored in Site-CN-██'s Low Temperature Biological Sample Room █. By order of ██████, all research into SCP-CN-1123 has been terminated.
The Foundation has taken control of all 62 databases worldwide containing data on SCP-CN-1123, including the American National Center for Biotechnology Information database and the Chinese CBMDisc, and a team of no less than 15 personnel from the Media Monitoring Department are conducting monitoring on a constant basis in rotaitng shifts. All individuals or groups attempting to investigate, experiment, or decode information related to SCP-CN-1123 are to be located, made unconscious, and amnesticized using Class-A amnestics.
Description: SCP-CN-1123 is a segment of human DNA with no hereditary effect consisting of decryptable data. Following processing by the Cameron-Hernández self-decoding system, a large amount of simple information can be decoded with no apparent source.
The anomaly was discovered in 200█ when data from the Human Genome Project was first discovered by a group of Chinese scientists to contain anomalous information. This attracted the attention of the Foundation's Chinese branch, which dispatched personnel to administer Class-A amnestics to the individuals involved in interpretation work.
After investigation into SCP-CN-1123, the Foundation conducted large-scale experiments and discovered that 87.3% of non-coding DNA in the human genome either deciphered to garbage data under this scheme or was [DATA EXPUNGED] that could not be decoded; 5.8% was completely decipherable, and up to 11.3% was at least partially decipherable. In addition, it was shown that all DNA segments containing decipherable information do not mutate or produce drift, which may relate to the fact that Hume levels around these genes are higher than normal.
By observing the translated information, it was discovered that the information contains basic information relating to mathematics, physics, astronomy, [REDACTED], chemistry and biology known to a Type 0.5 civilization on the Kardashev scale, as well as small amounts of religious and [REDACTED] information. It is theorized that the remaining undeciphered information consists of knowledge that has not been understood by humanity, and that a civilization capable of understanding 50% or more of the information in SCP-CN-1123 would be a Type II or higher on the Kardashev scale. Foundation researchers' views on the undeciphered information in SCP-CN-1123 differ widely, and some researchers theorize that SCP-CN-1123's information may come from [DATA EXPUNGED].
It is currently unknown whether other species' blank DNA segments contain SCP-CN-1123, and research is currently underway terminated on order of [REDACTED].
Identifier: SCP-CN-1123-23█
Date: 200█/█/█
Position: Chromosome █, q21.██
Nucleotides: CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATTCATCTCC
Decoded content: 3[unknown symbol]1415926535
Analysis:
- Decoded text appears to be the first 11 digits of pi.
- The unknown symbol is probably the decimal point.
Researcher: Dr. Wu ██████
Identifier: SCP-CN-1123-42█
Date: 200█/█/█
Position: Chromosome █, p14.█
Nucleotides: ACTTGACGCTACAAGAGCAAGGAGATGTCATCTATGTTATAGATGCAATAACT
Decoded content: unknown symbol α]²+[unknown symbol β]²=[unknown symbol γ]²
Analysis:
- Decoded text appeared similar to Pythagoras' theorem.
- The formula is valid only for right triangles on flat planes.
Researcher: Dr. Song ████████
Identifier: SCP-CN-1123-47█
Date: 200█/█/█
Position: Chromosome █, p32.█
Nucleotides: CAAGGAGATGTCATCTATGTTATAGATGCAATAACTTGACCAAGCCCGTTCCCATGA
Decoded content: [Atomic structure of benzene (C6H6)]
Analysis:
- After specialized processing, the decoded content appeared to be nearly identical to the chemical structure of benzene.
- This information was originally thought to be indecipherable, but was decoded due to similarities with the benzene ring structure.
Researcher: Dr. Jiang ███████
Identifier: SCP-CN-1123-48█
Date: 200█/█/█
Position: Chromosome █, q13.██
Nucleotides: TCTAGAGGTCTCGCTCGTGACCAAGCCCGTTCCCATGAAGCTTATCGATTCTATGTTATAGAT
TCTACAAGAGCAAGGAGAATAGATGGGTTGCAACCTCTCGCTCGTGAC
Decoded content:$\hat [\text {unknown symbol }α] \Psi = [\text {unknown symbol }β] \hbar \frac{\partial \Psi}{\partial t}$
Analysis:
- This appears to be similar in structure to the Schrödinger equation in quantum mechanics, and contains several symbols that were automatically decoded to the same plaintext symbols.
- The $\hat [\text {unknown symbol }α]$ in the content is likely the Hamiltonian operator.
Researcher:Dr. Xie ██████
Identifier: SCP-CN-1123-61█
Date: 200█/█/█
Position: Chromosome █, p24.██
Nucleotides:TCTAGAG█████CTCGTGACCAAGCCCGTT███ATGAAGCTTATCGAT████████
CAAGGAGAATAGTGGGTTGCAACCTCTCGCTCGTG██████CCCGTTCCCATAGAGGTC
AG███ATGTCATC██████TATGTTATAGA
Decoded content: $\psi_n =█ \sqrt{\frac{1}{[\text {unknown symbol }β]█}}\sin \frac{[\text {unknown symbol }α]█ \pi g}{2[\text {unknown symbol }α]███ \sqrt{█(h+1)} \hbar}, -g < █ < g$
Analysis:
- This is similar to the "New explanation of Nicolaus equation of the Grand Unified Theory based on Bézout's theorem and conjectured influence of several parameters on its structure" published by He Xiyu in 2003. Parameters █ and █ in the text mirror those in the publication.
- The symbols [unknown symbol α] and [unknown symbol β] are likely the ██████████ and █████████████████。
Note: This information has been sent to the Chinese Academy of Sciences for further research.
Researcher: Zhang ████████
Identifier: SCP-CN-1123-[DATA EXPUNGED]
Date: [DATA EXPUNGED]
Position: Y chromosome, q11.███
Nucleotides: [DATA EXPUNGED]
Decoded content: And ███ said: "Let there be light," and there was light. And ███ saw the light, and it was good; and God [DATA EXPUNGED] the darkness.
Analysis:
- This is similar in content to the first chapter of the Book of Genesis.
- The decoded content may contain an antimemetic infohazard, and has been redacted.
- [DATA EXPUNGED].
Note: That's it, I'm requesting that all decoding of SCP-CN-1123 be stopped. Let's not go into forbidden territory.
Researcher: [DATA EXPUNGED]
Extracts from ''Preliminary experiment results regarding SCP-CN-1123 and associated decoded information - Dr. Zhang █████████
…
According to the above analysis, the following conclusion can be reached: SCP-CN-1123 is natural, not artificial.
Besides a few exceptions, most SCP-CN-1123 register a stable, normal Hume level of 90-100/105-115 (environmental/individual) using Kant counters. This result can only be achieved if SCP-CN-1123 is a natural part of the human genome, providing a natural environment for normal EVE particles. …However, some information stands out as significantly exceeding the current knowledge of this world, and therefore the conclusion drawn is: Humans themselves are a type of anomaly that has developed to the current level of civilization, but whose existence cannot be effectively explained. However, it is because of this that humans have necessarily taken their position as the most advanced species of the animal kingdom.
…
As a result, SCP-CN-1123 only benefits the Foundation and human society as a tool to discover further scientific theories, and may be appropriately described as "the Creator's gift to mankind".
…
Extracts from ''Final (5th round) experiment results regarding SCP-CN-1123 and associated decoded information - Dr. Zhang █████████
…
Latest research shows that occasionally, quantum entanglement occurs between SCP-CN-1123 instances, and as a result all research on SCP-CN-1123 was immediately stopped. Relevant information can no longer be examined in depth…
…
At the end of 4 months of research, our view is that the SCP-CN-1123 anomaly exceeds what we are currently able to research and understand. Therefore, sealing and restricting access to SCP-CN-1123 is the best and most conservative approach available.
…
Warning: The following document is restricted to 4/CN-1123-21 clearance.
Unauthorized access will be recorded and subject to disciplinary action.
DATA CLEARED
A message from ███ ███████
That's right, the warning above is fake. You haven't entered any credentials.
Although my conclusion was rejected by those foolish researchers, I still wanted to hide these words here, so you can understand the correct way to look at SCP-CN-1123.
Humans are not as great as they think they are. Far from it. Many of our Foundation researchers even thought of this as "God's gift to humanity". What a joke.
The way I look at it, the human race is very possibly just the data storage mechanism of a higher civilization. The DNA in our bodies is just the storage for their basic scientific knowledge. There is nothing to be proud of here. We may very well be storing the address of a porn site that some stupid kid in the higher civilization has bookmarked. And one day, when they retrieve the information and erase it, our only purpose to exist will be gone too.
Why do we think of ways to transmit our genes to the next generation? What compels us to conceive and raise our descendants? This kind of instinct is puzzling, isn't it? And why is there an excerpt from the Bible in there? Where did our religion come from?
So I hope you understand. The birth of human civilization may only be an accident of life. We are only intelligent relative to other creatures on Earth, so the foolish among us believe we are the most intelligent. But do you see that 87.3% of undecipherable information? How many things in this universe do we not know? Although the deciphering of SCP-CN-1123 has ceased, I hope one day it will resume, for those who read this document will understand:
The human race is insignificant, yet the fools do not know.[]