Welcome to the Hub of the Chinese-Speaking SCP Foundation
The contents of this page are currently [unclassified].
Personnel are reminded that certain files within this hub may be subject to various classifications, and that verified credentials may be necessary to access those files.
Operational Information on SCPs
- Visit the Chinese wiki
- About the Chinese wiki
- Chinese Branch Groups of Interest
- Secure Facilities Locations-CN
- Mobile Task Forces-CN
List of SCP-CNs
Series 1
- SCP-CN-001 - Awaiting De-classification [Blocked]
- CODE NAME: Darkequation - Bamboo Scroll
- CODE NAME: Anglia - The Dragon Vein
- CODE NAME: Veleafer - Deduction Department
- CODE NAME: Re_spectators - Substitution Reaction
- CODE NAME: Ninth II - Wonderful Everyday
- CODE NAME: All Things Are One S - Jiang Yu
- SCP-CN-002 - Theory of Innocence
- SCP-CN-003 - Bare Curse
- SCP-CN-004 - Just a Dream
- SCP-CN-005 - Cold Trail
- SCP-CN-007 - Service-Oriented Creatures
- SCP-CN-008 - The Crown
- SCP-CN-009 - Question, Solve, Answer
- SCP-CN-010 - Aye-aye
- SCP-CN-011 - Bag Humans
- SCP-CN-016 - Sunken World
- SCP-CN-026 - No Longer be Alone
- SCP-CN-037 - Foundation Camera
- SCP-CN-046 - "Freedom" Fighters
- SCP-CN-048 - A Failed Attempt
- SCP-CN-052 - Coins
- SCP-CN-066 - OMG! What the Foundation Has Failed to Do for 20 Years Was Done by SCP-CN-066 in Just 4 Seconds…
- SCP-CN-073 - Pity For His Suffering, Yet Anger At His Indifference
- SCP-CN-077 - Shattered Stardust
- SCP-CN-086 - "How to Make a Tornado with Only a Spoon"
- SCP-CN-096 - "Stop" "Door"
- SCP-CN-111 - The Solitary Venerable One
- SCP-CN-114 - Pine of Awakening Smoke
- SCP-CN-120 - Heaven's Gate
- SCP-CN-121 - The Badge of Dr. Sun Yat-sen
- SCP-CN-, 00122 - Fifthist Memetics
- SCP-CN-127 - God's Dice
- SCP-CN-128 - Dominoes
- SCP-CN-143 - Zha
- SCP-CN-145 - Hometown
- SCP-CN-161 - Interpreter
- SCP-CN-163 - "Mobile" Phone
- SCP-CN-166 - Embryos
- SCP-CN-171 - Dormitory Manager
- SCP-CN-173 - Mr. Custom
- SCP-CN-176 - Uncle Sweets
- SCP-CN-180 - SPEEDCORE GENERATOR!!!
- SCP-CN-188 - A Staunch Materialist
- SCP-CN-190 - Peripheral Lobsters
- SCP-CN-193 - None Of Your Business
- SCP-CN-200 - Dolls Bringing Children
- SCP-CN-201 - Choo-choo Train
- SCP-CN-203 - Cat Crisis
- SCP-CN-204 - Thunder Trial
- SCP-CN-205 - An Unfinished Match
- SCP-CN-216 - Ancient Roman Ballistic Shield A Door to Somewhere
- SCP-CN-223 - With the Shadow We Be Three
- SCP-CN-224 - Till the Mountains Fall
- SCP-CN-228 - Buddha in the Clouds
- SCP-CN-233 - Dot Matrix
- SCP-CN-237 - Calculating Chickens
- SCP-CN-259 - Person of Interest
- SCP-CN-282 - A Black Go Stone
- SCP-CN-285 - Solo TRPG
- 丂匚卩 句丹丂卄 匚几 句丹丂卄 丅山口 几丨几乇 丂丨乂 - 卄丹几乙丨 从乇从乇
- SCP-CN-299 - An Abridged History of Human Evolution
- SCP-CN-303 - The Price of Truth
- SCP-CN-312 - What Does She Know?
- SCP-CN-326 - In Fading Books A Digital Music Fantasy Is Reborn
- SCP-CN-357 - Seeing Green Elephants
- SCP-CN-366 - Exist
- SCP-CN-369 - Self-Declaration Rostrum
- SCP-CN-392 - Your Little Bird Friend
- SCP-CN-394 - Humanail
- SCP-CN-404 - Memetic Immunity Disease
- SCP-CN-412 - Beauty Camera
- SCP-CN-424 - Baking Symphony
- SCP-CN-430 - The Cart Before the Horse
- SCP-CN-440 - Immortals of the Table
- SCP-CN-444 - Heavenly Sounds
- SCP-CN-445 - A Failed Anomalous Document
- SCP-CN-455 - This Is My Battle
- SCP-CN-463 - Grandma(Archived)
- SCP-CN-475 - Entombing
- SCP-CN-514 - Insomnia
- SCP-CN-529 - No Longer Human
- SCP-CN-534 - Mr. Dialect
- SCP-CN-546 - Our Secrets
- SCP-CN-606 - All of Everything
- SCP-CN-610 - Jiàn
- SCP-CN-625 - Piano Bridge
- SCP-CN-626 - Object Class
- SCP-CN-647 - Extreme Abuse
- SCP-CN-661 - Dick, St. Dick
- SCP-CN-666 - Hold the Bottom Line
- SCP-CN-673 - A bunch of statues what move when you dun look at dem
- SCP-CN-675 - The Great Kyet Khaewt Device
- SCP-CN-678 - Stranger
- SCP-CN-713 - Keyboard Fish
- SCP-CN-717 - Throat Forest
- SCP-CN-731 - Black Sunset
- SCP-CN-756 - Book of Numbers
- SCP-CN-757 - Tiny World
- SCP-CN-758 - Mini-Foundation
- SCP-CN-767 - Chart Syndrome
- SCP-CN-796 - Electrotherapy
- SCP-CN-797 - The Wandering Train
- SCP-CN-801 - Beyond Uranus
- SCP-CN-805 - Magic: The Gathering
- SCP-CN-810 - "Gold Foil"
- SCP-CN-829 - Spherical Potatoes
- SCP-CN-844 - The Seed of Lovesickness
- SCP-CN-861 - The pedestrian in a painting
- SCP-CN-879 - Programmable Office Building
- SCP-CN-909 - Closed Narrative Loop
- SCP-CN-918 - Ever-Drifting Paper Plane
- SCP-CN-930 - The blood-stained souls, the defects of the pineal gland became clearer and clearer
- SCP-CN-937-J - A Useful Toilet
- SCP-CN-964 - I'll turn on the Bluetooth and listen to some tunes
- SCP-CN-980 - J
- SCP-CN-985 - Exam Shark
- SCP-CN-994 - Forgotten Hometown
- SCP-CN-999 - Spreading Your Wings
Series 2
- SCP-CN-1000 - 2300
- SCP-CN-1001 - Writing Ends Here
- SCP-CN-1002 - A Morgue in Deep Space
- SCP-CN-1008 - Matter-Saving USB
- SCP-CN-1018 - Fires of Wangloss
- SCP-CN-1029 - Barn Full of Corn
- SCP-CN-1034 - Probability Machine
- SCP-CN-1037 - Ass See Pee, how much suffering you've caused!
- SCP-CN-1041 - Cat Care for the Office Worker
- SCP-CN-1044 - Parting Station
- SCP-CN-1050 - "Aquarius"
- SCP-CN-1056 - Little Lingual Fairies
- SCP-CN-1066 - "Huaxi" Second-Hand Phone Shop
- SCP-CN-1076 - "Have another bottle"
- SCP-CN-1080 - A Silent Bell
- SCP-CN-1089 - Fat Cat, Wild Cat and Fat Cat
- SCP-CN-1099 - Tin of Sardines
- SCP-CN-1109 - Project Longinus
- SCP-CN-1114 - Father of Mice
- SCP-CN-1123 - CTTGGGAGATGAATAGATGGGTTGCAACCCATCTATT……
- SCP-CN-1129 - Crematory Oven
- SCP-CN-1138 - Anime Must Be Destroyed
- SCP-CN-1145 - A Nonexistent Elevator
- SCP-CN-1169 - An Impure Fiction Society
- SCP-CN-1174 - Royal Quiet Deluxe Typewriter
- SCP-CN-1188 - Box Couriers
- SCP-CN-1203 - Cassius Protocol
- SCP-CN-1210 - The Cassette of Moon
- SCP-CN-1239 - Invisible Corpses Cover This City
- SCP-CN-1246 - DESIGNATED OBJECT TITLE
- SCP-CN-1256 - SCP Foundation Chinese Branch Chronicle
- SCP-CN-1260 - Origin of Species, or Machinery of Creation
- SCP-CN-1270 - talk cooler pill by dado
- SCP-CN-1276 - "Zekkōchō Conveyor Belt Sushi Restaurant!"
- SCP-CN-1296 - Tactical Cats
- SCP-CN-1298 - Emergency Exit Signs
- SCP-CN-1313 - The Staff of Dreams and The Buddha's Finger Bone
- SCP-CN-1318 - Volcanic Donuts
- SCP-CN-1330 - There Can Only Be One
- SCP-CN-1357 - Online Wayback Machine
- SCP-CN-1376 - A Safe-Class Anomaly
- SCP-CN-1391 - hamster pill by dado
- SCP-CN-1409 - 4200006200
- Work Notes: SCP-CN-1417
- SCP-CN-1420 - When Will That Day Come
- SCP-CN-1424 - not spicy mouthwash by dado
- SCP-CN-1440 - Camellia
- SCP-CN-1459 - 2d pill by dado
- SCP-CN-1463 - Catgirl Training Plan
- SCP-CN-1471 - John Aristides Silva, Eater of Worlds
- SCP-CN-1483 - Those distant, cold stones
- SCP-CN-1486 - HMCL Department
- SCP-CN-1500 - pʰoʃma
- SCP-CN-1501 - Mipicu
- SCP-CN-1512 - Tissue Box Birds
- SCP-CN-1515 - Headphone Party
- SCP-CN-1535 - Cities, for Better Lives
- SCP-CN-1548 - Universe Starfish
- SCP-CN-1552 - In Your Walls
- SCP-CN-1604 - A Gun That Gets More Powerful As It Kills More People
- SCP-CN-1606 - One-Third of an Umbilical Cord
- SCP-CN-1616 - Chinese Pseudoginger
- SCP-CN-1621 - become cat pill by dado
- SCP-CN-1666 - Veilbreak
- SCP-CN-1670 - Writing Mosquitoes End Here
- SCP-CN-1675 - Welcome!
- SCP-CN-1691 - A machine looking for loved ones
- SCP-CN-1720 - The Emperor's New Clothes
- SCP-CN-1733 - The Empty Patches of Sky
- SCP-CN-1735 - The One-in-Three Logistical Model
- SCP-CN-1767 - What is Papa's Mama Called?
- SCP-CN-1780 - Red Light, Green Light
- SCP-CN-1802 - Suppose you are Li Hua…
- SCP-CN-1814 - New Games
- SCP-CN-1819 - Library
- SCP-CN-1831 - Human-repelling Incense
- SCP-CN-1835 - The day the music died. Except for you.
- SCP-CN-1837 - USB Sword
- SCP-CN-1852 - The nth Reich
- SCP-CN-1875 - Pataphysics is bubbling, controlling the narrative is really cool
- SCP-CN-1920 - J-Q-X, three brothers, see fish eyes and dig them out
- SCP-CN-1921 - A Crawling Seal
- SCP-CN-1969 - Fuck This Guy's Mom
- SCP-CN-1976 - Little Red Book
- SCP-CN-1987 - Plunger
- SCP-CN-1997 - When Magic and Science Intersect
- SCP-CN-1999 - Remnants of Fantasy
Series 3
- SCP-CN-2000 - Chaos Theory
- SCP-CN-2008 - Area-01
- SCP-CN-2019 - Forbidden Borderline Θ
- SCP-CN-2028 - Hey Kids, Come Play!
- SCP-CN-2035 - Terminal Entertainment!
- SCP-CN-2043 - The Final Outcome You Want
- SCP-CN-2062 - Yes. No. No.
- SCP-CN-2063 - Warning: Misleading Information
- SCP-CN-2065 - Giving Life to Stone
- SCP-CN-2067 - Hello, I'm a Cyber-Kitty.
- SCP-CN-2082 - Wedding Day
- SCP-CN-2105 - Born in the Tomb
- Riddle-2108: Danbi
- Riddle-2109: God
- SCP-CN-2124 - Mendeleev's Matching Game
- SCP-CN-2141 - I Do Not Go Towards The Mountain, Rather The Mountain Comes To Me
- SCP-CN-2145 - Pāramitā and Qingming
- SCP-CN-2153 - Fading Memories
- SCP-CN-2161 - Homework from Dad
- SCP-CN-2169 - Unknown Love of the Digital Galatea
- SCP-CN-2171 - Waiting
- SCP-CN-2176 - Zero-Calorie Biscuits
- SCP-CN-2183 - What A Pebble
- SCP-CN-2186 - When Alex Thorley goes to their office, their coworker always pretends to be dead
- SCP-CN-2200 - Super Extradimensional Operation
- SCP-CN-2215 - A Literary Opinion
- SCP-CN-2227 - Drunk Alone
- SCP-CN-2262 - Spotlight and Shadow
- SCP-CN-2270 - Rainbow Mount
- SCP-CN-2290 - Unidentified Flying Mushrooms
- SCP-CN-2300 - 1000
- SCP-CN-2304 - The Sun is Tired of Rising
- SCP-CN-2345 - Memory-Carrying Enoki
- SCP-CN-2349 - Flood Tide
- Cover Facility Dossier: Site-CN-2366
- Observation File #CN-2380 - When Spring Comes
- SCP-CN-2399 - Still Raining
- SCP-CN-2401 - Sick Hall
- SCP-CN-2402 - The Star Nearby
- SCP-CN-2403 - Dodgeball
- SCP-CN-2405 - Ronald McDonald
- SCP-CN-2406 - … would much rather have KFC!
- SCP-CN-2426 - McNugget Fundamentalism
- SCP-CN-2427 - KFC Original Recipe Fried Chicken Serving Guidelines
- SCP-CN-2429 - Weak Fingers
- SCP-CN-2435 - Labor Pain
- SCP-CN-2440 - A video of torturing tubers
- SCP-CN-2446 - Amputation Assassin
- SCP-CN-2458 - That's The Way The Cookie Crumbles
- SCP-CN-2469 - Omnipresent
- SCP-CN-2470 - Release
- SCP-CN-2478 - A Fried Chicken Ritual
- SCP-CN-2489 - English Horn
- SCP-CN-2497 - Weeeee——
- SCP-CN-2510 - Metanormalcy
- Defiler SCP-CN-2512
- SCP-CN-2517 - A Man Who Cannot, In Fact, Fly
- ⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀ - ⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀
- SCP-CN-2574 - Self-Disrespect
- SCP-CN-2586 - The Abnormality Institute does not exist.
- SCP-CN-2601 - The Memories We Should Have
- SCP-CN-2604 - Peeling
- SCP-CN-2620 - Birthday
- SCP-CN-2622 - The Tabletop Prophet
- SCP-CN-2623 - Mr Wang, Mr Wang
- SCP-CN-2626 - D4C
- SCP-CN-2627 - Watch Out for Fires
- SCP-CN-2631 - Aliens Speaking English
- SCP-CN-2636 - MTF-己申-20 ("We")
- SCP-CN-2652 - Chopsticks
- SCP-CN-2677 - The Fracture of the End
- SCP-CN-2692 - An Innate Tendency
- SCP-CN-2696 - A Lighthouse on the Plateau
- SCP-CN-2699 - Harry Potter and the After-Reading Revision Questions
- SCP-CN-2701 - Line-of-Sight Prison: Earth
- SCP-CN-2736 - Will Bird to Bird Responsive Sing
- SCP-CN-2740 - Addictive Minecraft, Sentient NPCs, Digital Lies, Longing for Reality
- SCP-CN-2752 - I See the Machine Core Before the Mechanical Revolution.
- SCP-CN-2753 - A Unidirectional Mechanical Energy Supply Device,
- SCP-CN-2754 - Overturning the Inequality of Humanity.
- SCP-CN-2755 - Myriad Creatures Arise From the Ocean,
- SCP-CN-2758 - Spear of Aeglos
- SCP-CN-2763 - 口
- SCP-CN-2764 - Dragon's Hoard
- SCP-CN-2781 - Before Sleeping
- SCP-CN-2782 - ⭕
- SCP-CN-2785 - "Star" stands for "Nearby"
- SCP-CN-2792 - Detected incorrect characters. Revert to previous version?
- SCP-CN-2806 - Slickness
- SCP-CN-2823 - The Only Possible Outcome
- SCP-CN-2835 - Where am I?
- SCP-CN-2845 - Lament of the Short Days
- SCP-CN-2861 - Put Litter In Its Place
- SCP-CN-2868
- SCP-CN-2878 - Very Annoying Mosquitoes
- SCP-CN-2879 - Very Big Strainer
- SCP-CN-2880 - Very Sharp Sword
- SCP-CN-2906 - Barrier-free Service
- SCP-CN-2913 - A Purple "W"
- SCP-CN-2918 - The Pleasant Sound of Rain
- SCP-CN-2926 - Big Prime Number
- SCP-CN-2938 - ⠓⠊⠣⠀⠧⠕⠇⠞⠁⠛⠑⠀⠙⠕⠀⠝⠕⠞⠀⠞⠳⠡
- SCP-CN-2951 - The Shadow of the Moon
- SCP-CN-2965 - Killing Adolphe
- SCP-CN-2980 - Your Copper Sulfate Friend
- SCP-CN-2982 - No. 3 High School
- SCP-CN-2987 - Don't Look Up
- SCP-CN-2988 - Do Not Go To The Top Floor
- SCP-CN-2989 - DEMONSTRATION OF THE PRECENCE
- SCP-CN-2991 - Why disbelieve ye in the revelations of Anormaly, when ye bear witness
- SCP-CN-2993 - Falling In
- SCP-CN-2999 - Observator Ex Machina
Series 4
- SCP-CN-3000 - Eternal Glory to all Nodes
- SCP-CN-3018 - Crows
- SCP-CN-3019 - The American Dream
- SCP-CN-3022 - Green Means Go
- SCP-CN-3025 - You won. Was it worth it?
- SCP-CN-3040 - Red Cord
- SCP-CN-3049 - Dumpling Wrapping Paper
- SCP-CN-3077 - North Korean Sunset
- Archived Document CN-3079 - The First Sound in the Present
- SCP-CN-3086 - Shitworm
- SCP-CN-3087 - Traffic Jam
- SCP-CN-3103 - Give the Genitive a Rest
- SCP-CN-3112 - A Meaningless Ship
- SCP-CN-3123 - heart throbbing pill by dado
- SCP-CN-3132 - The Divine Needle Stabilizing the Sea
- SCP-CN-3146 - The Five-Corner Game
- SCP-CN-3164 - Rolling Coconuts
- SCP-3172 - Go Forth, and Never Look Back
- SCP-CN-3180 - Elastic
- SCP-CN-3201 - At least I can read these characters…
- Riddle-3204: The Old Man in the Sky
- SCP-CN-3211 - Who Shaves the Shaver?
- SCP-CN-3225 - McDonald's in Space
- ███ Recipe Book - Typhoon Shelter-Style SCP-CN-3235 with Salt and Spices
- SCP-CN-3252 - Inimate Boyfriend Project
- SCP-CN-3320 - Step Parents
- SCP-CN-3334 - Give me back my Santa Claus!
- SCP-CN-3349 - The Need to Sleep
- SCP-CN-3350 - The entire Surrealistics Department was killed on April 6, 2004
- SCP-CN-3359 - Wash Your Hands
- SCP-CN-3410 - Affix Alteration
- SCP-CN-3440 - Click Here to Skip Ad
- BARRIER SCP-CN-3441 BARRIER
- SCP-CN-3463 - Open the Boxes
- SCP-CN-3468 - Fireflies and Grenades
- So Spicy
- SCP-CN-3505 - Medical Waste
- Archive #3508 - A Record About Spring
- SCP-CN-3513 - The OPERATOR Protocol
- SCP-CN-3549 - Sanguineus Oiran
- SCP-CN-3550 - An International Misunderstanding
- SCP-CN-3556 - Incorrect password. Please try again in 26645 days.
- SCP-CN-3607 - Blueberry Biscuits
- SCP-CN-3668 - That's why we can't break free
- SCP-CN-3691 - Thank You, JFK
- SCP-CN-3692 - Donald and his Animal Friends
- SCP-CN-3693 - A Really Really Really Really Big Kitty
- SCP-CN-3709 - Sea of Beijing
- SCP-CN-3731 - Seven Sheaths Bleeding
- SCP-CN-3743 - Inner Expressions
- SCP-CN-3804 - The Face of Death
- SCP-CN-3811 - Shhhhh…
- SCP-CN-3838 - Der Freischütz
- SCP-CN-3879 - Click Here to Continue Reading
- SCP-CN-3930 - Red Star
- The investigation report of SCP-CN-3969 is under evaluation.
- SCP-CN-3971 - Flash touch
- SCP-CN-3979 - Death, Second Only To Never Having Lived
- SCP-CN-3980 - Fifth Floor
- SCP-CN-3982 - No. High School
- SCP-CN-3989 - Cybernetic Nomads of the Internet
- SCP-CN-3990 - Hachimi
Series 5
- scp-cn-4073 - dado shift key
- SCP-CN-4173 - Sculptures - Incomplete
- SCP-CN-4260 - Peas stand for 「9:3:3:1」
- SCP-CN-4328 - Merry Christmas, Mr. Lawrence
- SCP-CN-4789 - Not With Words
List of Explained SCP-CNs
- SCP-CN-116-EX - A Dazzling, Lively Relic
- SCP-CN-3300-EX - The Lamb has Died
List of Joke SCP-CNs
- SCP-CN-021½-J - Evil Salt Shaker
- SCP-CN-044-J - don't know
- SCP-CN-123-J - How Many Urinals Do We Need?
- SCP-CN-213-J - The Magical Geoduck
- SCP-CN-404½-J - "The Foundation is FAKE!"
- SCP-CN-421-J - The Great Radish
- SCP-CN-555-J - Hurts Like Hell!
- SCP-CN-579-J - Challenge titled "Series One, Keter, Humanoid, J"
- SCP-CN-666-J - Mew Mew Mew
- SCP-CN-846-J - Tit for a tooth… don't you think it's very naughty?
- SCP-CN-963-J - Extremely Annoying Codes
- SCP-CN-999-J - GOC Recruitment Notice
- SCP-CN-1616-J - WTF YOU SAID YOU DIDNT REVIEW
- SCP-CN-2000-J - Foundation's Bizarre Black-Technologies
- SCP-CN-2719-J - "Waifu"
- SCP-CN-3309-J - Program development plan for supratopic virus program for cardiac arrest in Syria (Trial version)
- SCP-CN-3333-J - Evil Water Dispenser :(
- SCP-CN-3765-J - I'm Stuck
- SCP-CN-20210401-J - Super Tom!
- SCP-CN-DEEPL-J - Machine Translation Virus
- SCP-CN-NOOOOOOOOOOOOOOOOOOOOOO-J - When Can We Move Out
- SCP-CN-JPG-J - A Self-Generated Meme
- SCP-CN-EN-J - This user has been banned
Tales
- A Preliminary Study on Thaumaturgy (I)——EVE Particle and the Definition of Thaumaturges - by
JustinTrenchcoat
- A Preliminary Study on Thaumaturgy(II)——The Application of Thaumaturgy and Brief Introduction to Its Future - by
JustinTrenchcoat
- Doomsday - by
Archibald1
- The Plan Failed - by
Moyo
- Downvoted - by
ashausesall
- Oblivious - by
Dorothy-X
- Still, Work Needs to be Done - by
Andrew Boom
- Jarrod Nooh's Webinar: Becoming Ordinary - by
koi_Vicky Stan
- O5-3 is too hot - by
OxygenNine
- When we are no Longer the Hidden Ones - by
BELLOLCY
- Breaking the wall
- Welcome To Scp Market
- Immortal - by
Dorothy-X
- The Story Goes On - by
DrSee
- Special Containment Procedure - by
Anirahtak
- A Psychologist in the Foundation - by
Lyrics Linn
- Infas's Sandbox Page - by
Infas12
- Overture of 4k: Foundation-Fi - by
MScarlet
- Foundation Is Watching You - by
DF-thirteen
- A Person's Life - by
wenzhenze
- A Detailed Report of a Containment Breach - by
shashengdong,
Etinjat, Dr. Geng Li Si, Dr. Xue Feng
- A Brief Introduction about Origin and Early Development of the Three Witches Group - by
Hueyacuetzpali
- Neighbour's Child - by
Pimpernel_F_Wagner
- How the Foundation Does Body Check For a Reality Bender - by
W Asriel
- Introvert - by
Pimpernel_F_Wagner
- Falling Into Stars - by
Lyrics Linn
- They Always Wither In Silence Alone - by
DrSee
- Under the Whale - by MottHery (account deleted),
Monicaaacaaat
- Readily Comprehensible Antimeme Guide (Excerpt) - by
TimeElapsed
- my handsome husbando 682 gekioshi ooc warning - by
Tenth Lee
- She And "She" - by
Crazy_Tachanka
- Gimme a break plz. I really have no drop left. - by
copperia
- A Case of Uxoricide and Dismemberment - by
MDYw_RainTree
- Forty days in Poveglia - by
Hueyacuetzpali
- Civil War History: The eighth lesson of Foundation Academy History degree Class 101 (Excerpted) - by
A Lancelot
- Here Rests Jack Bright - by
Lyrics Linn
- The Blink Collection: The MTF Chapter - by
bitchangelover
- The Time of Rivers - by Diorite
- The Foundation's Death - by
Huskar_CN
- I want my gun. Change back! - by
zenghanliang
- Laugh. - by Certhia _familiaris(account deleted)
- K-96 Counter-Timefreeze Grenade - by
bitchangelover
- First as Tragedy, Then as Farce – an Analysis on the Foundation’s Ideology - by
Zihao Huang
- Fantasizing Again - by
woodenwolf
- Live In Death - by
Xypher_uins
- Dr Voctor's Elementary Lecture on Narrative Iteration - by
Veleafer
- As My Life Past Away - by
Lyrics Linn
- Photography Day - by
Baby Bat
- ⚠︎ ⬤⬤|⬤⬤⬤⬤⬤|⬤⬤|⬤? ⚠︎ - by
Dr Hormress
- Ship In A Turtle, but without ship at all - by
MDYw_RainTree
- The Hymn for Lord Bright - by
Etinjat
- UIU City Dossier: Hong Shing - by
MScarlet
- Sayonara Heaven - by
MScarlet
- Archived Lecture Log - S-CN133-220801-EXEC002 - by
UnnaHuz
- Rumsey Station - by
Jochoi
- SCPLIVE! Nine Days Monologue - Solo Albums and Character PVs - by initializercox does not match any existing user name &
la kanro
- A Battlefield For Idols - by
MScarlet
- Can Our Previous Meeting Just Be a Dress Rehearsal? - by
Agent Phage
- The Original - by
Ninth BB
- Anticulture - by
Ninth BB
- Ass Sea Pee, how many lives have you fucking ruined! - by Oblivionnnnn does not match any existing user name
- If Thanos Strayed In SCP Universe - by
Simon Arran
- Free Wi-Fi Upon Joining the Church - by
Infas12
- Human In Contain - by
QBLevi
- Honour Of Die - by
Adeptus Custodes
- Not forever and ever - by
Floodplain
- Damp Season - by Toricc does not match any existing user name
- Hecatolite - by
Lumina Mio
- Next Station - by
MScarlet
- A "Bloody" Incident on a Line of Tags - by
Sharia Vanilla
- saudade serenade - by
Esperanza_Cai
- Messenger RNA - by
leather_boots
- You Must Work Extremely Hard to Die Without Effort - by
DouglasLiu
- Top 100 facts about Scarlet King - by
Pololo
- Reverend Immortality - by
Alois-V
- Chronicle of the Dragon Ancestor
- The Scripture of the Seven Wondrous Treasures of the Endless Dreaming Myriad Heavens to Subdue the False Demons from Beyond - by
Etinjat
- The Poem In Dust That þǣre ealdan cæȝan duru - by
Etinjat
- The Fool’s Wandering Chant - by
Etinjat
- The Last Sight Robert Saw Before He Got Shattered - by
blackinblack
- The doctor needs to eat too - by
Dyosme
GoI-Format
- SPC-CN-001 - by
BenjaminChong
- SPC-CN-646 - by
breaddddd
ColorlessL
- SPC-CN-777 - by
breaddddd
- Note: Nobody Is The True Brave One From The West - by
Etinjat
- UIU File: 1996-005 - by
Etinjat
- Student Profile - S11013387 - by
MScarlet
- Project Proposal 2300-001 "An Outro for the Blues" - by Cryer Walker(account deleted)
- The Unbroken God - by
Etinjat
- GpExpress: Phy-Ele-T169534964, dado bought a key boar - by
Etinjat
- Artifact 021 - Morning Mushrooms - by
Silkworm Moth
- LTE-1969-Blaecca-Ford-Osmanthus-Spiral - by
Agent Phage
- か-B-0519 "Retrospective Dream" Sales Catalog - by
Quisqualis
- Ambrose Backrooms - by
soybean-hy
- Wonder 671 - Rjokang, the Dream of Motherland - by
Etinjat
- Location Dossier: Berinsk Special Administrative Zone
- み-P-0316 "Babelfish" Sales Catalog - by
tetsusquared
Canons
Is the disappearance of anomalies a dawn of the people gaining their order and resurgence, or a sunset of the story moving to the termination?
When you see what you believed in fades away, never exists, becomes ashes. Which voice will echo in your mind?
Is it sorrows of the desperate bell? Or is it first songs of the joyful bird?
You see, you know. A life must have its death, a death must had its life. The God is already dead, and died once before. But our belief has not change, we once pieced its dismembered body together, piece by piece like a puzzle.
We don't mind do to it twice.
——Certainly, they died, by Airalin_Knowledge
Wherever we are, whichever path we have chosen, we only have one goal, which is to end all sufferings.
I cannot let my eyes be blinded by rage and hatred,
as everything has its own way and right to exist.
What we have to do is not to destroy, but to guide, change, and to let all of us get along together better,
as destruction will only repeat the sufferings, and only change can end sufferings.
——The Way of Thorns, written by Izsac
「The Commune of Prosperity」is the only ruling party of the country. The leaders of The Commune, also hundreds and thousands of the members contribute for the foundation and construction of this country with the struggle of blood and flesh.All of the commune members should be with great faith and respect to The Commune and the four leaders of it. Be brave to fight against the enemy of the Commune and those traitors who try to divide our country apart. Those who fight for the Commune and country should dedicate their full life and will to it, be fully loyal to the Commune.
It is a fact that most of the people of the Commune love the Commune and are loyal to it. However, those power which tries to split the Commune has sneaked into the people of it or even the Commune its own, to incite the mass to be doubtful about the Commune and even against it then break the laws. Those enemies must be wiped out, without hesitation and mercy……
——All it Takes is One Night, by heartlessed
The only reason why there were things passing away, is because they were forgotten. Every bit of reality may become fantasy only in the next second, because they were not forgotten
——05-O, where "O" stood for "Oblivion"
He will remember countless disordered light and color. Poem and script will be printed deeply inside his brain. Every time he recalls the hideous truth, those man-made memories will stand forward and cover that piece of real memory.
——"Flow", by Ravenfield
The Foundation has doubled, and we still know ours, but what about the other? Are we mirroring each other hand in glove, or are we matter and antimatter that annihilate each other magnificently?
"No matter how their relationship with us was before, it didn't matter from the moment they were struck with such an exterminating disaster. They know that from now on, we are the only family they can trust."
——Long Dream, by dearMrD
The New Era, the New Horizon, the New Chances, the New Challenges.
Since now human have reach the last edge, it is the time to Re-recognize what is the definition of SCPs.
——Human, in Contain, by QBLevi
Staff of Foundation at all class, especially management, It is strictly forbidden to travel with public funds in the name of Group Of Interest Meetings or Cross-Site Securing activities……The legwork shall be carried out according to the needs of work and approved by supervisor.
"Did you not notify the leader of Japanese Branch?"
"I don't think Foundation still needs that branch. And, the Finishing Report I need to write for that is troublesome.""
——"Travel by Public Funds: The Amazing Adventure of Karldark", by Freedom Koo
This is the story of a struggle between anomalous organizations, a land of wars and conflicts, a group of missionaries filled with hope for the restoration of God, and a hospital.
That year the Western religion of the Broken God sailed east to Taiwan, where they built many hospitals to help the suffering.
The disabled were equipped with iron arms, and the sick relied on sophisticated machinery, thus they spread the word of the Broken God and promoted their concept of self-cultivation.
——"History Drowned in the Ash of Memories", by Etinjat
Regardless of how fascinating the comedy or devastating the tragedy, the world is still the world, and He is up there, watching us all.
"Perhaps the one thing that I've learned very well from these hundreds of years of history of our country and our organization is that the loyal and obedient are always executed, and the cunning and traitorous always rise to the top."
——"Turbulent Flow — Part Twelve", by Agt_LEAZOV
Humans have been separated from each other for too long. Languages, letters, printings, we have crawled slowly on the path of information exchange, until the invention of Internet. For each second of data rushing through fibers, its carried information has surpassed the sum of all written records in the past five thousand years. The Network oversees everything, the matrix connects everyone.
The teen held on to surrounding objects, fell back into his chair, and sent a connection request in high hopes. The chip in his head starts to run, the circuit structure starts to process the incoming data.
——"That's It", by silverIce
The word "parallel universes" stands for opportunities, challenges, and crises. On top of that, it represents endless possibilities.
"From here, we take steps into a new future."
——“The traitors of the world”, by GazerPara
One city, two phases, three faces —— This is a story of a "magical" world meeting a "thaumaturgical" world.
“I understand that in your eyes, our techniques are like magic. But your technology, in our eyes, is also magic, mysterious and unpredictable. Isn't it?”
——"The True Legacy", by MScarlet
Now show me your picture, of the gray, crazy future.
Armed with fire and swords, the nouveau riche, covered with white cloth, would come. In the streets or on the terraces, after hearing the trumpet, the nouveau riche would set us on fire in a few moments.
——"The Ugly Child of the River", by Heavyblues
SCP-2000 is crashing ever more frequently, Deus Ex Machina's power to restart the world is broken, so every newborn must have something missing… The Iteration is struggling to rebuild itself, some are working, some are suffering, and some are asking the reasonable question: Why we are still doing it? Do we even know?
SCP-2000 is first and foremost an anomaly, and a decaying one at that.
——"Transcription Malfunctioned Hub", by Agent Phage
Without the Veil, lacking all anomalous technologies and any deities to worship, the congenitally deficient Foundation has never lacked the courage to explore the unknown in a world where people are indifferent to the abnormal, even without the financial power and influence it prides itself on.
Humanity is standing in the light. We still need to learn to protect ourselves. We still need to learn to be in awe.
——"Welcome to be a Demarcator of the Frontiers", by initializerCOX
"Here we're gonna explore meme transmission in the Foundation's world-"
"You're right, but "Memeism" is a brand new SCP-CN canon hub initiated by Ninth BB. The hub takes place in a fantasy world called 'SCPverse', where those chosen by the authors are granted the 'Meme', which guides memetic power. You will play as a mysterious organization named the 'Foundation' and encounter anomalies with diverse personalities and unique abilities in the chaotic internet. Together, you will defeat memetic hazards, restore the rule of 'No pop culture references', and gradually uncover the truth of 'PK-class end of the world'."
"The cyberpunk-style reality digests innovation into a plethora of memes and tears creations into various electronic signals."
——"SCP-CN-1169", by Ninth BB
Good food.
"… Chicken McNuggets are absolute. Absolutely and mathematically, by their very nature, they are constant and immovable, uniform and unaffected by anything outside of them."
——"SCP-CN-2426", by Yoghurt_Jinchouge
Artwork pages
- 2521 Stickers First Round
- 【Artwork】682 VS 096
- Achievement Badges for Translators
- breaddddd's first tape warehouse
- breaddddd's second tape warehouse
- breaddddd's logo wall
- breaddddd's lil room for AIC
- breaddddd's pantry for AIC
- The Thousand Facets of Miracle and Fate
- New Facilities Insignia of Chinese Branch
- Foundation's Departments' Logos By OxygenNine
- Hideyama's Studio 2
- Game: The Foundation's Whack-a-mole
- melospiza66‘s Oceanography Center (Caution! Starfishs)
- If you want more cool ACS secondary class icons
- Chinese Mobile Task Force Artwork Collection
- Novalu's Picture Album (1)
- OxygenNine's Foundation Related LOGOS
- Ocher's Art Page
- ORRERY's work of art
- DoMC related artworks...Maybe
- q1000yeahs' Summer Special - For Summer Festival of Arts Division
- Ryoma's SCP Paintings
- Magical Girls (im bad lol)
- SCP-CN-3969 artwork collection
- SCP-CN-757 Advertisements
- Chairman 682's Demand
- SCPLive! Foundation Idol Project!! Comic Story: Person, Hands, Cage
- When the Whistle Goes (Foundation Chinese Branch Contest Banner Artworks)
- THREE
- Xywy S Artwork
- Yanjin-S0ng's Artwork
Others
- SCP-CN-1000 "Circulation" Contest Hub
- "Uncertain" To Be SCP-CN-2000 Contest Hub
- SCP-CN-3000 "Miracles / Fate" Contest Hub
- SCP-CN-4000 "Conundrum" Contest Hub
- Buried (Into the Coffin Alive) Hub
- 2020 WAIFU Contest (Two Days to Write! Ended)
- Component: Letters Theme
- Nobody notes for this template
- Basic Table ACS Component
- 2021 SCP-CN Wiki Annual Statistical Report
- The Semimonthly Hub
- Tremble of 5-HT, or Depersonalization of Asklêpios Hub
- 2023 "Absence" Canon Contest Hub
- The Hub for CN Hubs
- Department of Logic Hub
- Demarcators of the Frontiers Hub
- INTERNET IS THE BEST Hub
- Transcription Malfunctioned Hub
- Memeism Hub
- Sci-Fi Month
Additional information
Representatives
The Chinese wiki in this site is officially represented, and this hub is maintained by: MScarlet












